Review



control strain mruby2  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92

    Structured Review

    Addgene inc control strain mruby2
    List of yeast strains used in this study.
    Control Strain Mruby2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/control strain mruby2/product/Addgene inc
    Average 92 stars, based on 3 article reviews
    control strain mruby2 - by Bioz Stars, 2026-04
    92/100 stars

    Images

    1) Product Images from "Development of an Haa1-based biosensor for acetic acid sensing in Saccharomyces cerevisiae"

    Article Title: Development of an Haa1-based biosensor for acetic acid sensing in Saccharomyces cerevisiae

    Journal: FEMS Yeast Research

    doi: 10.1093/femsyr/foab049

    List of yeast strains used in this study.
    Figure Legend Snippet: List of yeast strains used in this study.

    Techniques Used:

    Schematic presentation of the biosensor and control constructs. For strain details, see Table . Haa1 with fusion proteins is expected to relocate to the nucleus upon acetic acid exposure. The biosensor output is the expression of the reporter ( mRuby2 or mCherry ), expressed under various synthetic promoters. Sizes of promoters and genes are scaled to represent their actual sizes and added BSs for the sTFs are indicated with black bars inside the promoters. Red arrows labeled with R and C refer to the mRuby2 or mCherry reporter genes. Cyan arrows labeled with T and BHT refer to mTurquoise2 or BM3R1-HAA1-mTurquoise2 .
    Figure Legend Snippet: Schematic presentation of the biosensor and control constructs. For strain details, see Table . Haa1 with fusion proteins is expected to relocate to the nucleus upon acetic acid exposure. The biosensor output is the expression of the reporter ( mRuby2 or mCherry ), expressed under various synthetic promoters. Sizes of promoters and genes are scaled to represent their actual sizes and added BSs for the sTFs are indicated with black bars inside the promoters. Red arrows labeled with R and C refer to the mRuby2 or mCherry reporter genes. Cyan arrows labeled with T and BHT refer to mTurquoise2 or BM3R1-HAA1-mTurquoise2 .

    Techniques Used: Construct, Expressing, Labeling



    Similar Products

    92
    Addgene inc control strain mruby2
    List of yeast strains used in this study.
    Control Strain Mruby2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/control strain mruby2/product/Addgene inc
    Average 92 stars, based on 1 article reviews
    control strain mruby2 - by Bioz Stars, 2026-04
    92/100 stars
      Buy from Supplier

    92
    Addgene inc mruby2 tubulin 6
    List of yeast strains used in this study.
    Mruby2 Tubulin 6, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mruby2 tubulin 6/product/Addgene inc
    Average 92 stars, based on 1 article reviews
    mruby2 tubulin 6 - by Bioz Stars, 2026-04
    92/100 stars
      Buy from Supplier

    93
    Addgene inc mruby2 tubulin 6 vector
    CLASP2 and G2L1 colocalize in 3T3-L1 adipocytes. A–B, Live-cell imaging of adipocytes cultured in complete media coexpressing <t>mRuby2-Tubulin</t> (magenta) and GFP-CLASP2-HA (A, green) or mCherry-G2L1-myc (B, green). Live cells were imaged using TIRFM on a 2-s acquisition interval. Time series images to the right of the whole cell image are used to highlight +TIP dynamics within the indicated ROI. C, Immunofluorescence images of adipocytes cultured in complete media cooverexpressing GFP-CLASP2-HA (green) and mCherry-G2L1-myc (magenta). Cells were fixed and immunolabeled for tubulin (inverted white). Bottom row is magnified ROI. ROI, region of interest. Scale bar = 20 μm.
    Mruby2 Tubulin 6 Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mruby2 tubulin 6 vector/product/Addgene inc
    Average 93 stars, based on 1 article reviews
    mruby2 tubulin 6 vector - by Bioz Stars, 2026-04
    93/100 stars
      Buy from Supplier

    92
    Addgene inc mruby2
    CLASP2 and G2L1 colocalize in 3T3-L1 adipocytes. A–B, Live-cell imaging of adipocytes cultured in complete media coexpressing <t>mRuby2-Tubulin</t> (magenta) and GFP-CLASP2-HA (A, green) or mCherry-G2L1-myc (B, green). Live cells were imaged using TIRFM on a 2-s acquisition interval. Time series images to the right of the whole cell image are used to highlight +TIP dynamics within the indicated ROI. C, Immunofluorescence images of adipocytes cultured in complete media cooverexpressing GFP-CLASP2-HA (green) and mCherry-G2L1-myc (magenta). Cells were fixed and immunolabeled for tubulin (inverted white). Bottom row is magnified ROI. ROI, region of interest. Scale bar = 20 μm.
    Mruby2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mruby2/product/Addgene inc
    Average 92 stars, based on 1 article reviews
    mruby2 - by Bioz Stars, 2026-04
    92/100 stars
      Buy from Supplier

    Image Search Results


    List of yeast strains used in this study.

    Journal: FEMS Yeast Research

    Article Title: Development of an Haa1-based biosensor for acetic acid sensing in Saccharomyces cerevisiae

    doi: 10.1093/femsyr/foab049

    Figure Lengend Snippet: List of yeast strains used in this study.

    Article Snippet: The control strain mRuby2+ containing the mRuby2 reporter directly fused to the C-termini of RPL13A encoding a ribosomal protein was constructed using the CRISPR/Cas9 technology, transforming a cut EC2_5 vector (Cámara, Lenitz and Nygård ) with an sgRNA targeting the RPL13A locus (GAAGGAAAATACAAAAATTG) and a dDNA containing the mRuby2 ORF amplified from pYTK034 (Addgene #65141) using primers with 40-bp sequences for in vivo homologous recombination.

    Techniques:

    Schematic presentation of the biosensor and control constructs. For strain details, see Table . Haa1 with fusion proteins is expected to relocate to the nucleus upon acetic acid exposure. The biosensor output is the expression of the reporter ( mRuby2 or mCherry ), expressed under various synthetic promoters. Sizes of promoters and genes are scaled to represent their actual sizes and added BSs for the sTFs are indicated with black bars inside the promoters. Red arrows labeled with R and C refer to the mRuby2 or mCherry reporter genes. Cyan arrows labeled with T and BHT refer to mTurquoise2 or BM3R1-HAA1-mTurquoise2 .

    Journal: FEMS Yeast Research

    Article Title: Development of an Haa1-based biosensor for acetic acid sensing in Saccharomyces cerevisiae

    doi: 10.1093/femsyr/foab049

    Figure Lengend Snippet: Schematic presentation of the biosensor and control constructs. For strain details, see Table . Haa1 with fusion proteins is expected to relocate to the nucleus upon acetic acid exposure. The biosensor output is the expression of the reporter ( mRuby2 or mCherry ), expressed under various synthetic promoters. Sizes of promoters and genes are scaled to represent their actual sizes and added BSs for the sTFs are indicated with black bars inside the promoters. Red arrows labeled with R and C refer to the mRuby2 or mCherry reporter genes. Cyan arrows labeled with T and BHT refer to mTurquoise2 or BM3R1-HAA1-mTurquoise2 .

    Article Snippet: The control strain mRuby2+ containing the mRuby2 reporter directly fused to the C-termini of RPL13A encoding a ribosomal protein was constructed using the CRISPR/Cas9 technology, transforming a cut EC2_5 vector (Cámara, Lenitz and Nygård ) with an sgRNA targeting the RPL13A locus (GAAGGAAAATACAAAAATTG) and a dDNA containing the mRuby2 ORF amplified from pYTK034 (Addgene #65141) using primers with 40-bp sequences for in vivo homologous recombination.

    Techniques: Construct, Expressing, Labeling

    CLASP2 and G2L1 colocalize in 3T3-L1 adipocytes. A–B, Live-cell imaging of adipocytes cultured in complete media coexpressing mRuby2-Tubulin (magenta) and GFP-CLASP2-HA (A, green) or mCherry-G2L1-myc (B, green). Live cells were imaged using TIRFM on a 2-s acquisition interval. Time series images to the right of the whole cell image are used to highlight +TIP dynamics within the indicated ROI. C, Immunofluorescence images of adipocytes cultured in complete media cooverexpressing GFP-CLASP2-HA (green) and mCherry-G2L1-myc (magenta). Cells were fixed and immunolabeled for tubulin (inverted white). Bottom row is magnified ROI. ROI, region of interest. Scale bar = 20 μm.

    Journal: Molecular & Cellular Proteomics : MCP

    Article Title: Insulin Induces Microtubule Stabilization and Regulates the Microtubule Plus-end Tracking Protein Network in Adipocytes *

    doi: 10.1074/mcp.RA119.001450

    Figure Lengend Snippet: CLASP2 and G2L1 colocalize in 3T3-L1 adipocytes. A–B, Live-cell imaging of adipocytes cultured in complete media coexpressing mRuby2-Tubulin (magenta) and GFP-CLASP2-HA (A, green) or mCherry-G2L1-myc (B, green). Live cells were imaged using TIRFM on a 2-s acquisition interval. Time series images to the right of the whole cell image are used to highlight +TIP dynamics within the indicated ROI. C, Immunofluorescence images of adipocytes cultured in complete media cooverexpressing GFP-CLASP2-HA (green) and mCherry-G2L1-myc (magenta). Cells were fixed and immunolabeled for tubulin (inverted white). Bottom row is magnified ROI. ROI, region of interest. Scale bar = 20 μm.

    Article Snippet: To generate pLenti-iRFP670-Tubulin, tubulin was first subcloned out of the mRuby2-Tubulin-6 vector and into piRFP670-N1 (Addgene #45457, a gift from Vladislav Verkhusha). iRFP670-Tubulin was then subcloned out of the piRFP670-Tubulin vector and into the pLenti backbone to generate pLenti-iRFP670-Tubulin.

    Techniques: Live Cell Imaging, Cell Culture, Immunofluorescence, Immunolabeling

    The effect of insulin on CLASP2 +TIP dynamics. Live-cell imaging of adipocytes serum-starved for one hour and subsequently stimulated with 100 nm insulin. Live cells were imaged using TIRFM on a two-second acquisition interval. A, Single frame of live-cell imaging of adipocytes coexpressing GFP-CLASP2 (green) and mRuby2-Tubulin (magenta) at basal state (top row) or 10 mins (bottom row) following insulin stimulation. CLASP2 is displayed in inverted white to highlight +TIP density. B, Quantification of CLASP2-containing +TIP density per unit area (μm2) in adipocytes at basal state or 10 mins following insulin stimulation. Percent increase in CLASP2-containing +TIP density is indicated to the right. Statistical comparison made by paired parametric t test, n = 5 cells. C, Temporally color-coded projection of GFP-CLASP2 localization during a 30 s live-cell imaging interval. The length and extent of color overlap of time-projected CLASP2 localization indicates reduced displacement and hence lower velocity of CLASP2-containing +TIPs during the imaging interval in adipocytes after 10 mins of insulin stimulation. D, Quantification of CLASP2-containing +TIP velocity in adipocytes at basal state or 10 mins following insulin stimulation indicates reduced velocity of CLASP2-containing +TIPS after insulin treatment. Statistical comparison made by unpaired parametric t test, n = 123–125 CLASP2-containing +TIPS from five cells. Scale bars = 5 μm. E, Image of entire cells in the basal state (left panel) or 8 mins post insulin treatment (right panel) extracted from supplemental Video 2. Time series images under the whole cell image are used to highlight insulin-stimulated +TIP dynamics within the indicated ROI. F, Time series extracted from supplemental Video 2 of the indicated ROIs at either the basal state or at 4 mins post insulin treatment to present an example of changing CLASP2 microtubule plus-end dynamics with insulin stimulation. G, Live cell CLASP2-containing +TIP dynamics of the ROI extracted from supplemental Video 2 were captured in the basal state followed by stimulation with insulin. Each insulin-stimulated CLASP2-containing +TIP trail length time point was compared against the basal CLASP2-containing +TIP trail length to test for significant differences. t test; *p ≤ 0.05, **p ≤ 0.01. Red circles represent outlier data points. ROI, region of interest. BAS, basal. INS, insulin. Scale bar = 10 μm.

    Journal: Molecular & Cellular Proteomics : MCP

    Article Title: Insulin Induces Microtubule Stabilization and Regulates the Microtubule Plus-end Tracking Protein Network in Adipocytes *

    doi: 10.1074/mcp.RA119.001450

    Figure Lengend Snippet: The effect of insulin on CLASP2 +TIP dynamics. Live-cell imaging of adipocytes serum-starved for one hour and subsequently stimulated with 100 nm insulin. Live cells were imaged using TIRFM on a two-second acquisition interval. A, Single frame of live-cell imaging of adipocytes coexpressing GFP-CLASP2 (green) and mRuby2-Tubulin (magenta) at basal state (top row) or 10 mins (bottom row) following insulin stimulation. CLASP2 is displayed in inverted white to highlight +TIP density. B, Quantification of CLASP2-containing +TIP density per unit area (μm2) in adipocytes at basal state or 10 mins following insulin stimulation. Percent increase in CLASP2-containing +TIP density is indicated to the right. Statistical comparison made by paired parametric t test, n = 5 cells. C, Temporally color-coded projection of GFP-CLASP2 localization during a 30 s live-cell imaging interval. The length and extent of color overlap of time-projected CLASP2 localization indicates reduced displacement and hence lower velocity of CLASP2-containing +TIPs during the imaging interval in adipocytes after 10 mins of insulin stimulation. D, Quantification of CLASP2-containing +TIP velocity in adipocytes at basal state or 10 mins following insulin stimulation indicates reduced velocity of CLASP2-containing +TIPS after insulin treatment. Statistical comparison made by unpaired parametric t test, n = 123–125 CLASP2-containing +TIPS from five cells. Scale bars = 5 μm. E, Image of entire cells in the basal state (left panel) or 8 mins post insulin treatment (right panel) extracted from supplemental Video 2. Time series images under the whole cell image are used to highlight insulin-stimulated +TIP dynamics within the indicated ROI. F, Time series extracted from supplemental Video 2 of the indicated ROIs at either the basal state or at 4 mins post insulin treatment to present an example of changing CLASP2 microtubule plus-end dynamics with insulin stimulation. G, Live cell CLASP2-containing +TIP dynamics of the ROI extracted from supplemental Video 2 were captured in the basal state followed by stimulation with insulin. Each insulin-stimulated CLASP2-containing +TIP trail length time point was compared against the basal CLASP2-containing +TIP trail length to test for significant differences. t test; *p ≤ 0.05, **p ≤ 0.01. Red circles represent outlier data points. ROI, region of interest. BAS, basal. INS, insulin. Scale bar = 10 μm.

    Article Snippet: To generate pLenti-iRFP670-Tubulin, tubulin was first subcloned out of the mRuby2-Tubulin-6 vector and into piRFP670-N1 (Addgene #45457, a gift from Vladislav Verkhusha). iRFP670-Tubulin was then subcloned out of the piRFP670-Tubulin vector and into the pLenti backbone to generate pLenti-iRFP670-Tubulin.

    Techniques: Live Cell Imaging, Imaging